Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX499
Clone ID NPX499
Vector pGT1&delta
Project baygenomics

Sequence tag NPX499
Sequence
GGGTCGGGTAGCCTTCCGGGCTGCACGCGGTAAACCTGGATAGCTTTGGTGGGTGCTGTGCAGCCACCTGGTGGTGTCGC
TTCACCTGTGTGTCCCAGGAAGCAGTCCCTTTCTGCCCTGGTCGTGGGACGACTGCCAACCCCTCCTTTGGCCCTGCAAG
GCTCTGGCCACGCGTCCAGAGGGGCGTTGTGGCCAGTGGGACCCTCCAA
Sequence Type mRNA
Unitrap ID UNI9917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70893430..70893638 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041975 (Mettl8) NP_663499 methyltransferase like 8 Gene [Source:MGI (curated);Acc:Mettl8-002]

 
Come back to gene ENSMUSG00000041975


For any suggestions or comments, please send an email to unitrap@crg.es