Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST4822
Clone ID OST4822
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST4822
Sequence
GTGCTATTTTGGTGCCTTAATNAAAATCGGATTTTGAANTGGCCTTCAGCTTGGGAGCCAATGGCGTCATGACCGATTAC
CCCACAGCCCTGAAACACTACCTGGACAAGCAGGAANAANANACCCAGCCTCCTCAGCCTGAGGCCCTGTCCTGTCTTTC
TCTTAAAAAATAAATATTTTCTTGTCAGTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133918968..133919159 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030703 (Gdpd3) NM_024228 glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

 
Come back to gene ENSMUSG00000030703


For any suggestions or comments, please send an email to unitrap@crg.es