Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST4365
Clone ID OST4365
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST4365
Sequence
AGCTTCAGCGACAATGGGATTATGAAAGNAAGTTGGGCTCCTCGGAGGACTCAGGGACGGATCGATTCTCCTCCAATACC
AGTGGAAGCTCAGGGCGCAAATTCAAGTGATTTCAAGAAAGAAGCCACAGACCTAGAGCCCTACCTCGTGTCTGTGTTAA
GCCATTGAGACAGGAGTTCCAAGAAGGCTTTGATGGATTGTGCACATAGGGAAGATCTTGCTAGAAACTTCCCTGGGCTT
CCTCCCTTATTCTTGTGTGTGTGCGCGCGCACACACGCACNTGTGTTGATGGGGAAGGGGT
Sequence Type mRNA
Unitrap ID UNI28487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81734358..81734658 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031682 (1700011L22Rik) RIKEN cDNA 1700011L22 gene Gene [Source:MGI Symbol;Acc:MGI:1914937]

 
Come back to gene ENSMUSG00000031682


For any suggestions or comments, please send an email to unitrap@crg.es