Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC054
Clone ID XC054
Vector pGT1Lxf
Project baygenomics

Sequence tag XC054
Sequence
GACTGCCGGCTGGAGGCCGGGACCGCGGGCCAAGCGCGCGCGATGCCTCACTTCACCGTGGTGCCGGTGGACGGGCCGCG
ACGCGGCGACTATGACAACCTCGAGGGGCTCAGTTGGGTGGACTACGGCGAGCGCGCCGAGCGGGAAGACTCGGAC
Sequence Type mRNA
Unitrap ID UNI9928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108489826..108489981 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017765 (Slc12a4) NM_009195 solute carrier family 12, member 4 Gene [Source:MGI (curated);Acc:Slc12a4-001]

 
Come back to gene ENSMUSG00000017765


For any suggestions or comments, please send an email to unitrap@crg.es