Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC191
Clone ID XC191
Vector pGT1Lxf
Project baygenomics

Sequence tag XC191
Sequence
TGTCATTTGGTGCGGGAGGGAGCGCGAGAGCGGCGGTCGAGCCTCCGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACA
GGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAG
CCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGC
CGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGG
CCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACC
GGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTC
AAAA
Sequence Type mRNA
Unitrap ID UNI9932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120440830..120442881 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025132 (Arhgdia) NM_133796 Rho GDP dissociation inhibitor (GDI) alpha Gene [Source:MGI (curated);Acc:Arhgdia-001]

 
Come back to gene ENSMUSG00000025132


For any suggestions or comments, please send an email to unitrap@crg.es