Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD005
Clone ID XD005
Vector pGT1Lxf
Project baygenomics

Sequence tag XD005
Sequence
CTCAATTTCAGGCATTCTGGGAACGGAAAGACTGGTGAGCATCAAACGGTCGTTACTCATTTTCAGGTGGTTTGGGTTTT
CAGGCGGTCTGGGCTGTAAGCCAGAGACCGGCCCAGTACTCTGAAGTATGCAGAACTTGTCGTCATTGCCTACCCCTCTA
CACTGGTCTGGAGCTGACTTAGTAAGAACTGAAGGCCATGGATGAAGATGAAATTGAATTGACCCCAGAAGAAGAAAAGT
CATTCTTTGATGGAAT
Sequence Type mRNA
Unitrap ID UNI9937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 96295..133817 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]

 
Come back to gene ENSMUSG00000053211


For any suggestions or comments, please send an email to unitrap@crg.es