Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD006
Clone ID XD006
Vector pGT1Lxf
Project baygenomics

Sequence tag XD006
Sequence
CAGCCCATGGTGAGTGTCAATCAGGAAGCTCACCCTCTGCCCCAGTCCCCTCCATGTAGCCAGTGTGCTAATATAATGGC
TGGTGTTGCCCTAACACAGTTTCATTTAGGCGATCAAGAGAACCTGGTGCATCAGATACCACCACCGACGTTGCATGGTA
CCTCCCCTGACACACTCTTGCCAGACCCAGCATCAATCCTCAGGAAAGGGAAAGTGTTACATTTCGATGGAATTACAGTT
GTTACGGAGAAGCGTGAAGCTCTAACATCAAGCAATGGACCATTGGGTCCCACCACAGACAGTGCACAGTCAGGATTTAA
AGAGAGCATCATGGACTTACTTAGCAAGCCTGCAAAAAACCTGATAGTTGGATTGAAGGAACAGGAAGCTGCACCCTGTG
CCTGT
Sequence Type mRNA
Unitrap ID UNI9938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62300925..62301329 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047146 (AC166359.3) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9CY36]

 
Come back to gene ENSMUSG00000047146


For any suggestions or comments, please send an email to unitrap@crg.es