Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XD013
Clone ID XD013
Vector pGT1Lxf
Project baygenomics

Sequence tag XD013
Sequence
TCGTGCTGGTAAAGGTGGCTCAGGAGGCTGCCAAGGTGGCAGAGGCCTACCGGCAGCTGCATGCGGCCATGAGCCAGGAA
CCAGTGAAAGAGAACATCCCGTATTCGTGGGCCAGTGTGGCCTATGTGAAGGCCTACCACTATGGGGCCCTGGCTCACTA
CTTTGCGGCCACCCTCCTCATCGACCACCAGCTAAAGCCAGGCGCAGACGAGGACCACCAAGAGAAGTGTCTGTCCCAGC
TCTATGACCGCATGCCAGAAGGGATGACGCCGCTGGCCACGCTGAAGAATGCTGGGCAGCGTGTGCTGCTGGGTAAAGGA
CATCTGCACCGGGCCATTGGTTTTCACGAGGAGTCACTGAGGGAGGCCAACCTGTGCAAGAAGCTGCGTGACATTCAGGT
GCTCCGGGATGTGCTGTCTGCTGCCCATCAGCGCACTCAGCTCAAGCACACCCAGCACCGAGAGGATGACGCCCTTCTGA
ACCTCATTACCGCTCCAGATGTCCTT
Sequence Type mRNA
Unitrap ID UNI9940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36161332..36166549 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030494 (Rhpn2) NM_027897 rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI (curated);Acc:Rhpn2-001]

 
Come back to gene ENSMUSG00000030494


For any suggestions or comments, please send an email to unitrap@crg.es