Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0138
Clone ID CE0138
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0138
Sequence
GATGACTCCCACCTTTTGGTTCACTGCTACCTCTCCAGTTTTGTTCACAGAGAAGAGGACGGCCATCTGTTTTCCCAGCT
TTTAGACATGCTGAAGTTCTATACTGGCTTTGAGATTAACGACCAGACTGGAAATGCTCTGACAGAGAACGAGATGACCA
CGATTCACTATGACAGAATTACATCTCNGCAGAGGGCNGCCTTCGCACACTTCCCCGAGNTNNANGACNNNGCCNNNNNN
NTTTGCCCCGGGGGGGGTGAAGTTGAATTTTTTTTTTTTTTTTCTTTTGGGCCTCTCAGTTCAAACACACTCCACCAGGT
GGCATCATACCTCTGCCTCTTGCCAACGCTCCCTAAAAATGAAGACACAACTTTTGATAAAGAGTTTCTTCTAGAATTGC
TG
Sequence Type mRNA
Unitrap ID UNI1094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113971364..113976212 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es