Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE017
Clone ID XE017
Vector pGT1Lxf
Project baygenomics

Sequence tag XE017
Sequence
TTTTGGGAGGGGCCAACGTGAACTACAGGACAGAAGTGTTAAACAATGCCCCCATCCTGTGCGTCCAGTCTCACCTTGGC
CATGAAGAAGTTGTCACTCTCCTTCTGGAATTTGGCGCCTGCCTGGATGGGATGTCGGAGAACGGTATGAACGCACTGTG
CTACGCAGCTGCTGCCGGCCACATGAAGCTGGTGTGTGAGCTCTTCTAGATGGGGGCAAGGGTGGACCACTTGGATAAGA
AGGGCCAGTGTGCACTCGTCCACAGCGCACTGAGGGGCCACAGTGACATTCTCCAGTACCTGCTGAACTGTGAGTGGTCG
GCAGGCCCTCCCCAGCCTGGCACCCTGAGGAAGAGCCAAGCCCTGCAGCAGGCACTGACAGCCGCCGCCAGCATGGGCCA
CAGCTCGGTCGTCCAGTCCTTGCTGGGAATGGCAGAGGAACATGAAATCGAAGTCAACGGCACCGACACGTTGTGGGGAG
AAA
Sequence Type mRNA
Unitrap ID UNI9955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59653391..59658339 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es