Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2929
Clone ID OST2929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2929
Sequence
TGGGTCCTGGAGAATGCCGCTGTGCAGTCGGCAGCATCCTGAGTGAGGGGGAGGAGTCGCCTTCACCTGAGCTCATCCAC
CTCTATCAAAAATTTGGCTTCAAGATATTCTCCTTCCCAGCACCTAGCCATGTGGTCATAGCTACCTTCCCTTACACCAC
CCCCATATCCATCTGGCTGGCTGCCCGCCNAGTCCATCCTGCCTTGGATACCTACATCAAGGAGCGGAAGCTGTGTGCTC
ACCCTCNCCTGGANATCTACCAGCAAGACAAAATCCATTTCATNTGCCCACTGGCAAGGCAAGGAGATTTCTAC
Sequence Type mRNA
Unitrap ID UNI29231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106564767..106576064 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040813 (Tex264) NP_035703 testis expressed gene 264 Gene [Source:MGI Symbol;Acc:MGI:1096570]

 
Come back to gene ENSMUSG00000040813


For any suggestions or comments, please send an email to unitrap@crg.es