Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0060
Clone ID CE0060
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0060
Sequence
AAGGTGAAAAGAAATGGGCCGCTCCAATTCTAGATCACATTCTTCAAGATCCAAGTCTAGATCACAGTCTAGTTCTAGAT
CAAGATCAAGATCACATTCTAGAAAGAAGAGATACAGTTCTAGGTCTCGTTCCAGAACATATTCGAGGTCTCGTAGTAGA
GATCGTATTTATTCGAGAGATGATCGTCGAGATTACTGGAATAAGAGAGGACTGAGACGACCTTATGCGTAGTGACCAAG
GGGTAGAGGGTATAATCTTTTTTTTTTTTTTTAGATACCATCGAGGTGGCTATAGACCTGTCTGGAATAGAAGGCACTCT
AGGAGTCCTAGACGAGGTCGGTCACGGTCCAGGAGTCCAAAAAGAAGATCCGTGTCTTCTCAAAGATCCCGAAGCAGATC
TCGCCGGTCACAGACAGACAGACAGACATGCCCTTTG
Sequence Type mRNA
Unitrap ID UNI1097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20041807..20043060 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es