Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2755
Clone ID OST2755
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2755
Sequence
CAAACCCTTCACCGGCTGCATCCGCCACTTTGTAATTGACAGCCGCCCTGTGAGCTTCAGTAAAGCTGCCCTGGTCAGTG
GTGCTGTGAGCATCAACTCCTGTCCCACAGCCTGACACAGCTGCAAGGCTGCTGAAAACAGCTCTTCCTAACACTGAAAT
AAACATATTANTGGGGGGTCGGGAGGGTCAAAAGCCTGGAACTCCCCTCCCTACTNAAGCTCTCACCTGGTTAAAGGGGA
TTTCAATNAATCAAAAACCAGCCG
Sequence Type mRNA
Unitrap ID UNI14117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38829725..38829988 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019846 (Lama4) NM_010681 laminin, alpha 4 Gene [Source:MGI Symbol;Acc:MGI:109321]

 
Come back to gene ENSMUSG00000019846


For any suggestions or comments, please send an email to unitrap@crg.es