Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0057
Clone ID CE0057
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0057
Sequence
TTCTGAAAACTGCCTTGGATTCAAGCAGAACAGGTTTGCCAGATCTGCTGCAGGGCTTGTCGCCAGTGGAAACAGAGAAA
GGAGGAAACAATCCCTTGGCAAGAGCGCAGATCTCCCCTAGCCTAGAATACCAGCTGTGAGCACTTCTCTCAGTGGAGAT
CTTCATAGTGCAATCGGACCAAATCCTCTGGAAACATTCTGTATCTCAAATGCCCCGTGGAGTACACTCTTACCCAGACC
AACAGCAACCACCACTGCTCTTAAGACAGGTGGACCATCCTGTGGCTGCATTGTTCAACCATTTGAACAGGTCTTATGCA
AGATTACAGATGTCTGTGAGTTCATATGTACAAGATCAAGACAGACAAAAATCCGCAGCATGGAATCGGGGATGTGGGCA
TGATGTCCCATCTCTAGTTGAAGAGTAGCTG
Sequence Type mRNA
Unitrap ID UNI1099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 132277489..132296386 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043384 (Gprasp1) NM_001004359 G protein-coupled receptor associated sorting protein 1 Gene [Source:MGI (curated);Acc:Gprasp1-001]

 
Come back to gene ENSMUSG00000043384


For any suggestions or comments, please send an email to unitrap@crg.es