Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2370
Clone ID OST2370
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2370
Sequence
CTGATCGCTTTGATTCGAGCCAACTACTGGCAGAANCTGCTAAAGAGCATTTTGCCTCTGGTAGGCATCGCCATGGTGCC
GGCGCTCCTGGGACTGATCGGGTATCACCTGTACAGAAAGGCCAGCANACCCAAAGTCTCCAAAAAGAAGCTAAAAGAGG
AGAAACGAAACAAGAGTAAGAAGAAATAANTANTGGTTTTTAACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98554799..98555004 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003355 (Fkbp11) NM_024169 FK506 binding protein 11 Gene [Source:MGI Symbol;Acc:MGI:1913370]

 
Come back to gene ENSMUSG00000003355


For any suggestions or comments, please send an email to unitrap@crg.es