Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2166
Clone ID OST2166
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2166
Sequence
AACAACAATCCAGTAAGTTGCTGTATGATTGGAGGCATATGCAGGTATCTGTGCAAGGGCAACATTCTTCANAATGGCAA
TTGTGGAGTTACTAGTCTCAACTGCTGCAAGAGAAAATAGAGAAGAATCNAAGATCCAGTGAACCAAAGAAAACAATTTG
CACCTCCATGAANATGAACAAAACATAAACTAAATTAAAGTTCCTTGATTAAATGCAAACGCATGTTGGT
Sequence Type mRNA
Unitrap ID UNI13945

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19250711..19250939 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039785 (Defb5) NM_030734 defensin beta 5 Gene [Source:MGI (curated);Acc:Defb5-001]

 
Come back to gene ENSMUSG00000039785


For any suggestions or comments, please send an email to unitrap@crg.es