Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2165
Clone ID OST2165
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2165
Sequence
CGGCGCCATGACCACCAAGGGATCTGTTTCCCCTGCCCAGTTAATAAAGCCAGCATTGGATGGGGAAAAA
Sequence Type mRNA
Unitrap ID UNI29241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106335322..106340060 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023262 (Acy1) NM_025371 aminoacylase 1 Gene [Source:MGI Symbol;Acc:MGI:87913]

 
Come back to gene ENSMUSG00000023262


For any suggestions or comments, please send an email to unitrap@crg.es