Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2071
Clone ID OST2071
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2071
Sequence
GAGCAAAACCGTAGGANGCGACNNCGCCCCCCAGGCCTTTGGTANCNCCCNGAACTCTAAGAATNCCTNCCCCACTCCTG
CNNCCNGNGNGGTGGGTNCTNCGGATNCTATTTNANCCNCCTNCACATCGACTNCTACCCTCNTGAAGNTGCTGGAANCC
ATGAAACATCCCTCAACNGGANTCCNNCTGCTGTCTGAACAGAAGGGCCTTTCACCGTGCTGCTTCATCAGTGCTGAGGT
CNTACACTGGTTGATGAACAACGTGGAGGGGGTCCAGACGCAGGCGATGGGCATAGACATCATGCAGAAAATGCTGTGAA
GAGCAGCTCATNGCGCATGCATCTGGTGAACATGGGNGGACCTTCATCTANGGCTTCTATTTCTACNAGAATAGTTGTTG
GAGGGGAAA
Sequence Type mRNA
Unitrap ID UNI29245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33311289..33316551 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037426 (Depdc5) NM_177786 DEP domain containing 5 Gene [Source:MGI (curated);Acc:Depdc5-002]

 
Come back to gene ENSMUSG00000037426


For any suggestions or comments, please send an email to unitrap@crg.es