Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST2016
Clone ID OST2016
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST2016
Sequence
CAATTCTGGAGATGGAGAATAATTCCACCAATGAGAGATTTCCTGATCAACATCATTGAAGAGTCCTTAAAAACTTAACA
GACTTGTGTAACAGCACAAGTATGTTCCTAAAGTGCTGTATTTACTGAATCTGTTTCCTGGAAAAGTAATTAATAAAGCT
TATTCTCAGAGTGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40217695..40217873 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071014 (Ndufb6) NM_001033305 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI (curated);Acc:Ndufb6-001]

 
Come back to gene ENSMUSG00000071014


For any suggestions or comments, please send an email to unitrap@crg.es