Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE089
Clone ID XE089
Vector pGT1Lxf
Project baygenomics

Sequence tag XE089
Sequence
CTGAAAGTGGTGTCAGCAAAGCCCAAGGTGCACAACCGCCAGCCCAGAATCAACTCCTACGTGGAGGTGGCAGTGGATGG
ACTCCCCAGCGAGACCAAGAAGACGGGGAAGCGCATCGGGAGCTCTGAACTGCTCTGGAATGAAATCATCGTTCTGAATG
TCACAGCCCAGAGTCATTTGGATCTGAAGGTCTGGAGCTGTCATACCTTGAGGAATGAACTACTGGGCACTGCCTCTGTC
AACCTCTCCAATGTCCTGAAGAACAATGGCGGCAAAATGGAGAACACACAACTGACCCTGAACCTGCAGACAGAGAACAA
AGGCAGTGTTGTCTCGGGAGGAGAGCTGACAATTTTCCTGGATGGGCCAACTGTTGATCTGGGAAGTGTGCCTAATGGCA
GTGCAGTGACAGACGGATCACAGCCACCTTCAAGAGAATCCAGTGGGACTGCTATAGCTCCAGAGACCCGGCACCAGCCC
CCCAGTACAAACTGCTTTGGTGGCAGATCCCGGACGCACAGACACTCAGGTGGCTCAGCCAGGACAGCCACAGCAGCCAG
TGAACAAAGCCCTGGCGCTAGGAACCGCCACCGCCAGCCTGTGAAGAACTCTAGCAGCAGTGGCTTAGCCAATGGCA
Sequence Type mRNA
Unitrap ID UNI10004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109981341..110030331 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es