Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST1870
Clone ID OST1870
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST1870
Sequence
TTCCTGGGCTTTGATACCCAGTTGCTGATGGGTAACGTCGACACTCGCTGAGCCCCGAGGAGTATATTTTTGGAGCCCTC
AACATCTACTTAGACATTATCTATATCTTCACCTTCTTCCTGCAGCTTTTTGGCACCAACCGGGAATGAGGAGCCATCCC
CGCCCCCACCCCTCCTCCANAGAATGTCCCTTCCCTGTCCTGTGACCTCTCCGTGCTCCTGTGANACCAGACATAAACTC
GCTGCAGCCAGCTTGTGAACA
Sequence Type mRNA
Unitrap ID UNI28490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99330466..99330728 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023011 (Faim2) NM_028224 Fas apoptotic inhibitory molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1919643]

 
Come back to gene ENSMUSG00000023011


For any suggestions or comments, please send an email to unitrap@crg.es