Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE134
Clone ID XE134
Vector pGT1Lxf
Project baygenomics

Sequence tag XE134
Sequence
AGTATTCACCTCTCCTCGCTGAGCTCTGCACCCGAGGCTACCCCTCGCGCCTTAGGCCGACGCCATGAAGATCAAGGATG
CCAAAAAACCCT
Sequence Type mRNA
Unitrap ID UNI10011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35583358..35583449 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018846 (Pank3) NM_145962 pantothenate kinase 3 Gene [Source:MGI (curated);Acc:Pank3-001]

 
Come back to gene ENSMUSG00000018846


For any suggestions or comments, please send an email to unitrap@crg.es