Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE153
Clone ID XE153
Vector pGT1Lxf
Project baygenomics

Sequence tag XE153
Sequence
TTGGTTGGAGACAATAAGACGTGGGATGAGGCTCCGTGACAGAACGCGGTTCGGCCTGGGGATTCTGAAGACAAAAAGCT
TTGGACAGGCGAATTCATGGTCGTGGAAACCCCGCCCCAATTAAGCAATGTCAGGCGTCCGACCTCCCATCATGAACGGG
CCCATGCACCCCCGGCCCCTGGTGGCGCTGCTGGATGGCCGGGACTGCACAGTGGAGATGCCTATCCTGAAGGATGTGGC
CACAGTAGCCTTCTGTGATGCACAGTCCACACAGGAGATCCATGAGAAGGTACTGAATGAGGCTGTGGGTGCCCTGATGT
ACCATACCATCACACTGACCAGAGAAGATCTGGAGAAGTTTAAAGCTCTTAGAATCATCGTCCGAATTGGCAGCGGGTTT
GACAATATCGACATCAAGTCAGCTGGGGATCTAGGCATCGCAGTGTGCAATGTGCCGGCAGCATCTGTGGAAGAAACGGC
AGACTCCACCCTGTGCCACATCCTGAACCTGTACCGACGAACCACCTGGCTACACCAGGCCCTTCGGGAAGGCACTCGAG
TCCAGAGTGTAGAGCAGATCCGAGAGGTGGCTTCAGGAGCTGCCAGGATCCGTGGAGAGACCTTGGGCATCATTGGACT
Sequence Type mRNA
Unitrap ID UNI10016

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33601789..33612224 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037373 (Ctbp1) NM_013502 C-terminal binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201685]

 
Come back to gene ENSMUSG00000037373


For any suggestions or comments, please send an email to unitrap@crg.es