Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST1616
Clone ID OST1616
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST1616
Sequence
AGGTGTGGCCATCTCCTGTACACTCGGAGCGACCTTTGGCTACGTGGCTGGCCTGGTTATCTCGCCACCCTGGATCTACT
GGAATAGAAAGCAGCTTACATACAAGAACAATTAAGAGGAGAAAGGAGAGAAGTTATTTCTCTGTGCAGATTCCATAAGG
GCTGTGCAGAAGTTACATGGTCCAAGCCGGGCAGTCCATTTACAGCACTGTTGTTTTCTAAATGTCATTTCAACATGATG
TGATTGTAGCTTCTTAACTATGAAACCCCTGAGAGATTGTACCTTCTAGTTGAAATAAAGTATTTATTGT
Sequence Type mRNA
Unitrap ID UNI3240

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87396599..87396909 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024145 (Pigf) NM_008838 phosphatidylinositol glycan anchor biosynthesis, class F Gene [Source:MGI (curated);Acc:Pigf-001]

 
Come back to gene ENSMUSG00000024145


For any suggestions or comments, please send an email to unitrap@crg.es