Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE243
Clone ID XE243
Vector pGT1Lxf
Project baygenomics

Sequence tag XE243
Sequence
GGGCGCTGGAGAGCGAGGTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCTTCCTA
TAGATCCCGATGAAGACTCTGACAACAGTGCAATTTATGTGCAAGGATTAAATGACAATGTGACTCTGGATGATCTGGCA
GACTTCTTTAAGCAGTGTGGGGTTGTCAAGATGAACAAGAGAACTGGACAACCCATGATCCATATCTACCTGGATAAGGA
GACAGGAAAGCCTAAAGGGGACGCCACAGTGTCCTATGAAGATCCACCAACTGCAAAGTGCTGCCGTGGAATGGTTTGAT
Sequence Type mRNA
Unitrap ID UNI10020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4972816..4979523 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es