Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST1441
Clone ID OST1441
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST1441
Sequence
AGTTCTGATGGAGAGATATTTGAANTTGATGTAAAAATTGCCAAACAATCTGTGACTATCAAGACCATGCTGGAAGATTT
GGGAATGGATGATGAAGGAGATGATGATCCTGTTCCTTTACCAAATGTTNNTGCAGCAATTCTAAAGAAGGTCATTCAGT
GGTGCACCCACCACAAAGATNACCCTCCTCCTCCTGAGGATGATGAAAACAAA
Sequence Type mRNA
Unitrap ID UNI10878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52050360..52057179 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036309 (Skp1a) NM_011543 S-phase kinase-associated protein 1A Gene [Source:MGI (curated);Acc:Skp1a-002]

 
Come back to gene ENSMUSG00000036309


For any suggestions or comments, please send an email to unitrap@crg.es