Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST1431
Clone ID OST1431
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST1431
Sequence
CCTGTGTCTTTCCCTTGAACNNCCCTATCCTGACCAGGATTATCTGCCCANAGGAAGAAAGCGCTGAGGGAGCCATTTCT
TTGTGGAGTATCATCTCAAAAGTTAGAATTGAAGCCTGCATGTGGGGCATTGGAACANCCATTGGAGAGCTGCCTCCATA
TTTCATGGCCAGGGCAGCTCGCCTCTCAGGTGCTGAACCAGATGATGAAGAGTATCNNGAATTTGAANAAATGCTGGAAC
ATGCAGAGGCTGCACAAGACTTTGCATCACGGGCTAAACTGGCAGTNCAAAAACTAGTACAGAAAGTTGGATTTTTTGGA
ATTTTGGCCTGTGCTTCTATTCCAAACCCC
Sequence Type mRNA
Unitrap ID UNI29267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86424844..86457119 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018171 (Tmem49) NM_029478 transmembrane protein 49 Gene [Source:MGI (curated);Acc:Tmem49-001]

 
Come back to gene ENSMUSG00000018171


For any suggestions or comments, please send an email to unitrap@crg.es