Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE297
Clone ID XE297
Vector pGT1Lxf
Project baygenomics

Sequence tag XE297
Sequence
CTCGCTCTGGTCCCTGCGGCTGGCGGCCGAGCCGTGTGTCTCCTCCTCCTCTCGCCGCCATATTGTCTGTGTGAAGCTAG
GGGAGCGCGGCTATTGCCGCTGCCGCTTCCACCGCAGTGTGAAGAAAAAGGGTCTGAAACAAAGTCTTACCAACGTCTGC
TTTTGAACACAGTGACTGCTGGATCTTTAAACATCAAGTTCAGCTTTGTCTGTCAACCTGTCTGACATGTCGGGACCCGT
GCCAAGCAGGGCCAGAGTTTACACAGATGTTAACACACACAGACCCCGAGAGTACTGGGATTATGAATCACATGTGGTGG
AATGGG
Sequence Type mRNA
Unitrap ID UNI10005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152052612..152076346 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es