Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST884
Clone ID OST884
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST884
Sequence
TATTTCAGTTTAGAGCACTGAAAAAAGTGAGGATCTTTGACTCTCCTGAAAAGTTGCCCAAGGAAGCGCTCAAGTGTGCT
TACCATATCCAATAAGTATGGTATGCTCTTCGCTGGTGGCACCAATGGCTTGAATGTTTTTCCTACTAAAAGCCTTCTTA
TCCAAAATAAACCTGGANATGATCCCAATAAAATTGTTGACACAA
Sequence Type mRNA
Unitrap ID UNI29279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31832023..31832215 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es