Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST880
Clone ID OST880
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST880
Sequence
GCACCTCCAGTTCCAAGGAAATCACCTTTGGATTGAACAGAAACATGACTGCAGAATTTAAGAAGACAGACAAGAGTATC
CTGGTCAGCCCCACAGGCCTCTCCAGAGTGGCCTTTAACCCTGAGCAGAGGCCACTCCACGGAGTGCTGAANACCGCCAC
GAGCTCCCCGGCCAGCACTCCTCTGTCGCCCATGAGGCTACCAGCCACCACCCCAAANANAAGGCCAAGGGCTGCGGACT
TCTTCTGANAGCCAGAAGCCCTTTCTGAAGCCTGCTTTTATACCGGATGTTCTATAAATTATAACTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI3973

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32196232..32197550 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058392 (Rrp1b) NM_028244 ribosomal RNA processing 1 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rrp1b-001]

 
Come back to gene ENSMUSG00000058392


For any suggestions or comments, please send an email to unitrap@crg.es