Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST828
Clone ID OST828
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST828
Sequence
AGTGGATTGAGGGGGTGACNGGCCGGCGCATCGGGAACNACTTCATGGATGGCCTCAAAAACGGGATCATTCTTTGCGAA
TTTATCAACAAGCTGCAGCCGGGTTCTGTGAANAAGGTCAATGAGTCAACTCAGAACTGGCACCAGCTGGAGAACATAGG
TAATTTCATCAAAGCCATTACCAAGTATGGGGTGAAACCCCACGACATCTTTGAGGCCAACGACCTGTTTGAAAACACCA
ACCATACACAAGTTCAGTCCACTCTCCTGGCTCTGGCCAGCATGGCCAAGACAAAAGGAAACAAAGTCAATGTGGGAATC
AAGTATGCAGAGAAACAAGANCGGAGATTTGAGCCGGGAGAAGTTGAAGAGAAGCAGGAACATCATTGGACTGCAGATGG
GCCCAACAAGTTTGCCAGTCAGCAGGGCATGACGCCTACGGTACACGGCGTCACTCTATGATNCCAAACTGGGTTCAGAT
CANCTCTGGACCAGGCGAACATCGGCCTGCAGATGGGCACCAACAAAGGTGCCACCAGCTGCATGACTGCACAGCACCAA
GCGGCAATCTTTGACCAGTCTGGGCATGGAACACTGCANACCTCAAGTCGCTTGCAATGGCACACAAGGGGCTCCAAAGG
GC
Sequence Type mRNA
Unitrap ID UNI29282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21905628..21912537 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001349 (Cnn1) NM_009922 calponin 1 Gene [Source:MGI Symbol;Acc:MGI:104979]

 
Come back to gene ENSMUSG00000001349


For any suggestions or comments, please send an email to unitrap@crg.es