Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST816
Clone ID OST816
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST816
Sequence
CCGTATCTGACAATCCCTTGTGGCCCTGGAATNTTCTGAACCANTNNNAACATTGATCAANCNCCCGGNTNAATCCAAAG
TGCTGCNCTGGNNCANNGCCATGCCTGGCGTAAGCGGAGCNCACGGATGAATATCCTAAGCAGCCAAAGCCCACTGCATC
CTTCTACCCTGAATGCAGTGATTCACAGGACTCCGCATTGGTTCCATGGACGTATCTCCCGCGAGGAGTCTCACAGGATC
NTCNAGCAACAAGGTCTCGTGGACGGGCTGTTCCTCCTTCGTGACAGCCAGAGTAATCCAAAGGNGTTCGTACTGACNCT
GTGCCATCACCAGAAGATTAAAAACTTCCAGATCTTACCTTGCGAAGATGATGGGCAGACCTTCTTCNCTCTGGATGATG
GGAACACCAAGTTCTCCGATCTGATCCAGCTGGTCGACTTCTACAGCTCAACAAAGGTGTTCTGCCCTGCGAGCTGAAAC
ACCACTGCATCCGCGTTGGNCTTATGAACTCCTTGCCC
Sequence Type mRNA
Unitrap ID UNI29283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11833455..11837920 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es