Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC324
Clone ID XC324
Vector pGT1Lxf
Project baygenomics

Sequence tag XC324
Sequence
ATTTATGGCTAAATTAGGGCAGAAGAGGCCCAATTTCAAACCAGATATTCAAGAAATTCCGAAGAAACCTTGAGATGAAG
AAGAAGATACTGGAGATCCCTTTGGTTTTGATAGTGATGATGAGTCTCTACCTGTTTCTTCAAAAAATTTAGCCCAGGGT
AAGGGTTCATCTTACTCAGAATCTAGTGAGGCTGCTCAGCTGGAAGAAGTCGCTTCTGTATTTGAAGCTAATAGCAAATG
TAGTCATGTGGTGGGTGAAGACAGTTTTGCTTCCGACAGATGCTTACTTGTGGAGGATACTTTAATTGGGAAAGAGAAGA
GCATAAGTAGAATTCCAGAAGACAACGCAAACAAAAGTAGTTGCACTAAGTTGCTAACTT
Sequence Type mRNA
Unitrap ID UNI5570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35490278..35490657 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es