Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST560
Clone ID OST560
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST560
Sequence
GTAGGCATAGAGGGCCAAAATGGGAATGCCCTTCTCCCANAGATGTTCATGGTGCTCTGGCTCAAGGGAGTCACCTTCAA
CGTTACCACTGTGGACACCAACANACGGACAGANACTGTACANAAGCTCTGCCCCGGTGGGCATCTGCCGTTCTTGCTCT
ATGGCACCGAANTGCACACAGACACCAAAAGATCGATGAATTCCTGGAGGCCATGCTGTGCCCTCCCAGGTACCCAAAGC
TGGCTGCCCTGAAACCCTGAGTCCAACACCTCGGGACTGGACATATTTGCAAAGTTTTCTGCCTACATCAAGAACTCAAA
CCCAGCCCTCANTGACAACCTANAAAANGGACTCCTGAAAGCCCTGAA
Sequence Type mRNA
Unitrap ID UNI29289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35189395..35192202 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007041 (Clic1) NM_033444 chloride intracellular channel 1 Gene [Source:MGI Symbol;Acc:MGI:2148924]

 
Come back to gene ENSMUSG00000007041


For any suggestions or comments, please send an email to unitrap@crg.es