Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC337
Clone ID XC337
Vector pGT1Lxf
Project baygenomics

Sequence tag XC337
Sequence
GGTTGGAAAGTCGAGCATGATTCAGCGCTACTGCAAAGGCATTTTCACAAAAGACTACAAGAAAACCATCGGCGTAGACT
TTTTGGAGCGACAGATTCAGGTTAATGATGAAGATGTAAGGCTAATGTTATGGGACACTGCAGGTCAAGAGGAGTTTGAT
GCAATCACGAAGGCCTACTATCGAGGAGCCCAGGCTTGTGTGCTTGTGTTTTCTACCACAGACAGGGAATCTTTTGAAGC
GATTTCCAGCTGGAGAGAAAAAGTAGTAGCGGAGGTTGGAGATATACCAACCGCACTGGTGCAAAACAAGATCGATCTGC
TGGATGATTCATGCATCAAAAATGAGGAAGCGGAGGGACTGGCCAAAAGGCTAAAGCTGAGGTTCTACCGGACGTCCGTG
AAGGAGGACCTCAACGTGAGTGAAGTTTTTAAATATTTGGCTGAGAAACACCTACAAAAACTCAAACAACAAATAACCGA
AGATCCAGAACAGACACACTCAAGTAGTAACAAGATT
Sequence Type mRNA
Unitrap ID UNI10044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33780752..33795224 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004768 (Rab23) NM_008999 RAB23, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab23-001]

 
Come back to gene ENSMUSG00000004768


For any suggestions or comments, please send an email to unitrap@crg.es