Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC347
Clone ID XC347
Vector pGT1Lxf
Project baygenomics

Sequence tag XC347
Sequence
TCCCTCCCATTCTCGCGCCCTGGGACGGCGAGGCTGGAAAAAGGGGTTGAGAGAGCTGTTGGCCGCCGCCTTTAACTTGT
GCGTGGGGCGGCCATGTCGGCCGGCGAGGTGGAGCGCCTGGTGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAG
AGTGGCTGTATGGCGGCCCGTGGGACGTGCATGTGCACAGTGACTTGGCAAAGGATCTAGATGAGAATGAAGTTGAAAGG
CCAGAAGAAGAAAATGCCAGTGCTAATCCTCCATCTGGAATTGAAGAAGAAGCTGCTGAAAATGGCGTGGCAAAACCGAA
AGTGACAGAGACTGAAGACGACAGTGATAGTGACAGTGACGATGATGAAGATGATGTTCACGTCACTATAGGAGACATCA
AAACAGGAGCACCACAGTATGGGAGTTATGGAACAGCACCAGTAAATCTTAATATCAAGGCAGGGGGAAGAGTTTATGGA
AATACAGGAACCAAAGTCAAAGGAGTGGACCTCGATGCACCTGGCAGCATTAATGGAGTTCCACTCTTGGAAGTAGATCT
GGATTCTTTTGAAGATAAACCATGGCGGAAACCT
Sequence Type mRNA
Unitrap ID UNI10047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 74931612..74942184 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029227 (Fip1l1) NM_024183 FIP1 like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Fip1l1-001]

 
Come back to gene ENSMUSG00000029227


For any suggestions or comments, please send an email to unitrap@crg.es