Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XC368
Clone ID XC368
Vector pGT1Lxf
Project baygenomics

Sequence tag XC368
Sequence
AGAGAGAATCGTAGCAGATCTTGAGGAAGAAAACAGGAATCTGCAAGCAGAATATGATCGCCTGAAGCAGCAGCATGAGC
ATAAAGGCCTGTCTCCACTGCCGTCTCCTCCTGAGATGATGCCCACCTCTCCTCAGAGTCCCAGGGATGCTGAGCTCATT
GCTGAGGCTAAGCTACTGCGCCAACACAAAGGACGCCTGGAAGCCAGGATGCAAATCCTGGAAGACCACAATAAACAGCT
GGAGTCTCAGTTACATAGACTGAGACAGCTCCTGGAGCAGCCCCAGGCTGAAGCTAAGGTGAATGGCACCACGGTGTCCT
CTCCTTCCACCTCTCTGCAGAGGTCAGATAGCAGTCAGCCTATGCTGCTCCGAGTGGTTGGCAGTCAAACTTCAGAATCT
ATGGGTGAGGAAGATCTTCTGAGTCCTCCCCAGGACACAAGCACAGGGTTAGAAGAAGTGATGGAGCAACTCAACAACTC
CTTCCCTAGTTCAAG
Sequence Type mRNA
Unitrap ID UNI9581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82398489..82436039 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es