Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST227
Clone ID OST227
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST227
Sequence
GTCTGGTGCATGGAGAAGANTTTGAGCCCTCGTTCTGTTTTTACACCGGCTACAAAATCCCCATATGCAAAACCCTGGAC
CAGTATTTTGAGTTCATCCAGTCTCTGCCATCCCTCGATAACCCAGAAGTCTTTGGGCTTCACCCCAATGCCGACATCAC
GTATCNGAGTAACACAGCTTCCGACGTTCTTGAAACCATCACCAACATTCAACCGAAANAAANCGGTGGTGGTGTGGGCG
AGACGCGCGAGGCCATTGTCTACAGGCTGTCTGAGGACATGCTCANCAAGCTGCCCCCTNACTATGTGCCTCATGAGGTG
AAAGCTCGCTTGATGAAAATGGGTCNCCTGAACTCAANGAACATATTTCTTAGACAGGAAATTGACAGGATGCAGAAAGT
CTCTCAATCCTCCGCAGCAGCCTGAGTGACCTAAAACTGGCTATCGAAGGGACGATCATCTGNAGTGAGAAATTGAAAAA
TCNTTGGGAGGGGATGTTTGATGCNCGTNTCCTCNGCTTTGGGAAAAAAGGTGTTCCTGGGGAATCCCCCCCCCC
Sequence Type mRNA
Unitrap ID UNI29202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30977498..30991898 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]

 
Come back to gene ENSMUSG00000033826


For any suggestions or comments, please send an email to unitrap@crg.es