Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUb3p3h8fs
Clone ID PSTVUb3p3h8fs
Vector GTR1.3
Project vanderbilt

Sequence tag PSTVUb3p3h8fs
Sequence
TCCATTTGACCATGACCATGACCATGACCATGACAGGGTCTAAGTCTGTAGTATAACCTGGCCTCGAACACAATTTTGGC
AGTCTACTTTCAATCTTTGAGTGCTGAAATTATAGGTGTTTACCACCATGGTGGTGCTTCTGTT
Sequence Type genomic DNA
Unitrap ID UNI12904

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4786330..4786473 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es