Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb16h8
Clone ID PSTVUpb16h8
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb16h8
Sequence
AGGGGTGTGATTTTGCCAGCTGAAGGCAGTTTACATTCGGAGTTCCGCGGACTCTTCAGAGGCTGTAAAAATGCCGGAGT
CACGAAAGCCTGCAAAGAGCTGTTGCTTGCCTTGCTGCTGCTGCTGCTACTGCCGTCCCTGCCCGTGCTGCAGCTGCTAC
TCCTGCTGCTGCTGCTGCTGCTTGTTGCTGATTGTTGCGGTTGCTGGTTGCTGTTTACTGTTTGCTGCCGGCTGGATTGC
TGGATTGCTGATTGCCAGTCGGCGAAATCCTGGCGATGAAGATCCAACTTGCCCCAAGAAACAAGACGACCCTAAGAAGT
AGTCTAATGATTTCAATACGCCCTTTCCCCCTCTGACCTTTCTCTCTTCCTTATGCTGGGGGATTGGAAGGGTGGCAGAA
AAAAGAACCCAATAAAGTAGCCAAAAGTAAAAA
Sequence Type mRNA
Unitrap ID UNI14152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6989229..6989660 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063018 (2010204K13Rik) RIKEN cDNA 2010204K13 gene Gene [Source:MGI Symbol;Acc:MGI:1922859]

 
Come back to gene ENSMUSG00000063018


For any suggestions or comments, please send an email to unitrap@crg.es