Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb17b9
Clone ID PSTVUpb17b9
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb17b9
Sequence
AGGGAATCTGAAGCATGTGGTCTAGTTGACAAAAAGAGATCAGGTTCCCAGAGCTGGGCAGCAGTGCCTATAATGAAGAC
AGTGTGTTGATGCAAGCGGTTTGTGGAATTTGTGACTGCAGGGGAAATTTGGAAGAAATTACTTCCTGAAAATTTCCAAG
GGGCACCAAGTGGCAGCTGGCCTCCTGGGGTGGGGAGCCAGGCACCCCGGAGCCAGGCCTAAGGGGAAGAAGAAGATAGC
CAGTGTTTAAAGTGTTTATTTTAAAACACAAATGCAGTTTTTAATGGTTCAAAATTATTTTTAAGCAAGTTGGGGGGAAG
AATTTTATCTTCATAAAGGGGACAAGTCAGGAGCTGCAGAAGAGTGGGGTTGGGTAGGGGGGTCAGCAGATGGGCAGGTT
CGGCCCTCGGGGCCATTAGATAGAGACCTGTGGGGGAGGGGTATCAGCAGACTGGAGGTAAGGGGGAGTCTACCACTTTT
GTTTAGTATGATGCACTCCCGTTGTCCTAATAAACGTTTTGAAAATGTAAA
Sequence Type mRNA
Unitrap ID UNI14070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 99479977..99480509 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067567 (Hdac8) NM_027382 histone deacetylase 8 Gene [Source:MGI (curated);Acc:Hdac8-001]

 
Come back to gene ENSMUSG00000067567


For any suggestions or comments, please send an email to unitrap@crg.es