Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb19a3
Clone ID PSTVUpb19a3
Vector pGTR1.4
Project vanderbilt

Sequence tag PSTVUpb19a3
Sequence
ATAGTCCAGCCTCTGTAAGAAGAGAAAGAAGCTAAGTCCGACTAAGCATCCATCACGTCTGTCAGTGGTCCCGCCTCCCT
TCTTGTACAATCCAGAGGAATATTTTTATCAACTATTTTGTAAATGCGAGTTTTTTAGTAGCTCTAGAAACATTTTTAAA
AGGTGAGGGGATCCCACCTCATCCCATTTTTTAAGTGTAAATGGTTTTTTTAAGAGGTTAAATCATTTGCTGGTTGTTTA
TTTTTTGGTACAACCAGAAAATAGCAGGTATACTGTAATCAGGAGAGGCTGTGACTGTCTCGGGGGTCACCATAACATTC
CGTAGATGGGGCTAGTTTTATATCCTATAATACAAAGTATACTAAATGGCAATTTGGCGTCTCAGTCGTGCATTCGTGTC
TGAAATATTTTCAGTTCTATCTGGTCCCGTGTTTCTAGTAGAACCATTTTGTAAGAAAGCCAGTCCTTGGCCCTTGCCCT
GTCAGAACTGTGATGTCTGTGGTCATGGCAGTCCATTTTCCTAACAGTTGTGATAAGTGCTGTGAAAGATGGAAGTCCTG
AGTCTGTTCTGTGTGTGGCGTAACATTGTGAATTGGTGGGACTGAGATTACAGGCATTTGGTTGTTGTGAGAGGTCTTGG
GGGAACTTGCCGAGTCACTGGAACAAGTTCAAAGAAAAACAATACGTACTCTTCATTGNGGACAGGAACCNAGGNGACTT
CAGAATTGGGGTACGGGAACACGTATATGGCTCTTTTGGGGAAAGGTAATAAAAATGGGANGGTTGGANTCGGCTCCTCG
ACCAATAAA
Sequence Type mRNA
Unitrap ID UNI29301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96343213..96344024 735
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040681 (Hmgn1) NM_008251 high mobility group nucleosomal binding domain 1 Gene [Source:MGI (curated);Acc:Hmgn1-001]

 
Come back to gene ENSMUSG00000040681


For any suggestions or comments, please send an email to unitrap@crg.es