Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb18a12
Clone ID PSTVUpb18a12
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb18a12
Sequence
AGCATTACCTAGAGCCGCCAGTGTAAACTGTAATGAAGCTCTAGAGAGATACGGACTTTCTTGTGAGGATTTCTTCATAC
TGAAGCATGGAGAGTCGAGATACTTGAATACCGATGATAGAGCTTTTGAAGAAACATGAAACTAGGAATTTTCAGTGACA
ACAAAAGACTAAGAAATTCACAAATATTATGACACTTTTCACATGGAAACAATTTCTGCAAGTGTGTGTTTTGTTTTATA
TTATAACTTGCCAATTGATAAGACTAGCTTACATAAATTGTGGGAGTCTAGGGATGGGTTATTTAAGAAACTGTCCAAAA
TAGACTTTAAAAAACCATACCAATGATACAAACATTGCAAAATATTGTTTTTTATCAAACATTTTATTTTAGTGGCAGTA
AAATTTCTGAGGTGGGGAAAAACTGACATTAAAGTTCCATTTCTTTTTCTATTTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21170731..21171182 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044968 (Napepld) NM_178728 N-acyl phosphatidylethanolamine phospholipase D Gene [Source:MGI Symbol;Acc:MGI:2140885]

 
Come back to gene ENSMUSG00000044968


For any suggestions or comments, please send an email to unitrap@crg.es