Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb16f7
Clone ID PSTVUpb16f7
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb16f7
Sequence
AGGCTTATGTGGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGAGAATGGCTGAAGGATACATGT
GGTGCCAATGCCAAGCAGTCCCGGGACTGCTTTGGGTGCCTTCGAGAATGGTGTGATGCCTTCTTGTAGTGTTCTCTGGG
GATCCCTCATACCCCAGCCACAGCACAGTTTCCAAAGTCTGCAGCAGGGCAGGGCTCCTCCCTGTCCTCCATAAAGGAAA
AGATGGCTGTTGCCACCCTCACCTCCTATGTACTCCAGGGTCTATGGGGAGTTCTCTCCCCTCAGCGTTTCAATCTTTCT
GGGATCGTTTCCCTTGCATGCCTTTCCCTTCCACCTCCCCCTGCAGTTCCGTGGCAGCAGTTCCAACTTTCCTGAATGGA
TTCCTGGCCCCTTCTCCCTCACTATCTGTTGGATGCCCTTTGGCTCCTTTCCTTTTTTTGGCAAAAACAGTCACTGTCCT
TATAAAAGATTTTTAAATTAATAAAATCAGTGGTCTTCAAA
Sequence Type mRNA
Unitrap ID UNI11948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5364640..5365160 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024844 (Banf1) NP_035923 barrier to autointegration factor 1 Gene [Source:MGI Symbol;Acc:MGI:1346330]

 
Come back to gene ENSMUSG00000024844


For any suggestions or comments, please send an email to unitrap@crg.es