Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb14e1
Clone ID PSTVUpb14e1
Vector pGTR2.1
Project vanderbilt

Sequence tag PSTVUpb14e1
Sequence
AGCCTAACTATGGGACAGCTTTCGAGAAGGAAAAAGATGAAGATGGATTCTTGTATGTGGCCTACAGCGGAGAGAACACT
TTTGGCTTCTGAGGCCCTTGCTGGGCTAGGTGCGCCCTTCCTGCTTGTGTCTCTTGTAAATAACTGGCTGTTCTCAGTTA
CTCTGCCAGAGCCTCCACACAGACCTACTAGTGCATTTGTAACTGGATTTATTTCTTAATATATTGGAAGGTTTTGTTTC
CTTAGATTAGTAAATTATCATACAGAGTTTTATTTTCCGTTTTCTTTTTGTGCACTGTCCTCATGGCTATTTGCTCCAGG
GAACCTGTCCTCTGGGAATCATATTTAATGAAGATATTTCCGTAATGAAGGGAGGTAGGTGTGGTGGTAAAGGGAAAAGG
AGGGGCTGATGCATAGTTCTGGATTATGTTGAAAGTGTTAGATGGCTAAGTATTAAAGCACCCATATTAAATCCTTAGCA
ATCAGAACACTTGCTTCACTAGATTTTGCCACTGCAAATCATGTTGGACTGAGCTAATCTATTCTTCTTTCTGAGACTAT
TAAGGTAAATAATTAACAATAAAGCCTCCTTATAAGGCAAAA
Sequence Type mRNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114476213..114476815 583
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es