Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb21b9
Clone ID PSTVUpb21b9
Vector pGTR1.3
Project vanderbilt

Sequence tag PSTVUpb21b9
Sequence
AGAGTTATGAAGTGGAGAGCGTCCTTGGGAAGGAGATGGGACCTTTACTCTGCTTTGTCCAGTCCATCACTACACAGCAG
AGCAGCTGTGTCGTCACCCTGGAAGAGATTGAGCTGCTGAGTACAGAGGGAGCCACTGCTGCTCAGCCTCCTCCCTGACA
TCTGTGCGCTTGGCAAGGGGCTGTGTGTTAACTCAGTGTTTCTGTTTTTAAATTTAGTGGGTTTCTTTTCTTTCTTTTTT
CTGGTAAAGAGATTAATAGGATAGTTTTAAATTAAAAATCAAGATACCTCTAATACACATTTTTTTAAACTTTACCTTCC
TACAAGTTTGATAACATGTTTCTTTGAGTGTTTCTCATGTCTTCTGTGTCTTCATTTTGCAGCTACTTGGGCTTAGGAAA
GTGCTTTGTTGTAGCTTTAAAGTAGTTACAATTATCAATATTATATAGGTTTTTCCTTGCAGTATCTAATTTCTCTGCTA
GATGGTTCGGTAAAGCTTCAGCCAGTATCTCATATGGAAATATACTGTTCGGTTACAATAAATAAAGGTC
Sequence Type mRNA
Unitrap ID UNI29305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15889326..15889880 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es