Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb20d4
Clone ID PSTVUpb20d4
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb20d4
Sequence
AGATCGCAGCCTAGATCCTAGGGGAAGCAGGGTGGAGTCTCGCAGCACCATTTCCCCAGTTCACCACCGGCCCAAGACCC
GGACCAGTCCCAGACCTAGTCCAGAGGCAGTGGCTATTGGCCACGTGGTTCGCGCAGTGGAGCACCCCACAGAAGACCTG
GAAAACCGTATCCCTGGTACCCCTGGGCCCTGGCTGGTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGG
TGGGGGCGCGCAGCTTGCTCTGGAGATGGCAGCCGGAAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTA
GGTGAGGTCCCATAAGGTTCTAGCATGCAGGACCGCCAGGCTCTAAGCTTTTCCCTTAGAGCTTTAACCTGGTTTAGTAC
CTTCCCACTGCACATTGCACAGTGGAGTGGTCCCCACCCCTTCAAGACGCCAGTGGTATGGCCCTCCCAGAGCCAGAGCG
CTCGCACCCACCACCCCCACGTCCGCGTGCGCGCAGCTTCTCCTAGTCCCTTCCCGACCGGGAGGTAATAAAATAGTTGG
ATCCCAAAAAA
Sequence Type mRNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251754..7252319 558
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es