Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb19h2
Clone ID PSTVUpb19h2
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb19h2
Sequence
AGCGTGGGGGTCCAGAGTGACCGTCGTGGCTGCTGCTTGTCACCAGACAGAAGGGTTAGCTTTACAATAAAGGACTTCCA
CAATGTCAAATGAAAAGTCATATATTAAACAACCTTAATAAATATTCTGTGAGCAGAATGAAGTACAGAACCTCCAGGGG
GTCACTTGTATCTCCTACACTGGGTATCTCGGTCAGCTGCCCCACAAGCTGCCCGGTACACTTATTAAAGTCTACTTTTT
TATGCGCTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54005808..54006056 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021631 (AC162800.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101505982..101506230 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]

 
Come back to gene ENSMUSG00000061474


For any suggestions or comments, please send an email to unitrap@crg.es