Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb17f11
Clone ID PSTVUpb17f11
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb17f11
Sequence
AGCAAGCACGCTGACAGGCAGTGATCCAGAGACTGCTGGGGCAGAGAGAAGCTTACCTTCTATTTAATCTGAAGCCTTAG
AAACAATGCCTTCTGACCTCAAGAACACGTGGCTCTTAGTGAGCAGGCCGGAAGTTGCCTTGGGGGGAAATGATGAACAT
GTATTCTGCTCCATTTTACTAACCCGTCTACATTGTGAAAACTAACAGCTTGAAGCTCCTGACGGCCTTCCTGCCAGTTC
GCAAGTGTAGGCAGAACGCCAGTCCTGCCTTAGAAGAGGGAAGTGCATCACGTGGGGCTGCTGAGTTTCGGGTCATCTGC
GTTTTCCTTTCTTTGCTGAACTAATAAAGGCCAGTGCTTAGTCTTAAAAA
Sequence Type mRNA
Unitrap ID UNI25877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88953992..88954356 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]

 
Come back to gene ENSMUSG00000072553


For any suggestions or comments, please send an email to unitrap@crg.es