Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PSTVUpb18a5
Clone ID PSTVUpb18a5
Vector pGTR2.3
Project vanderbilt

Sequence tag PSTVUpb18a5
Sequence
AGGGACTTGTATTTGCGACTGGAGCACACACATTTCTTCAGTCATCATGGAGAAGGTGGACACTACCACTACGATACGAC
CCCAGACACAGTGGAGTACCTTGGATACTTCTCACCTGCACAGTTCCTCTATCGCATTGATCAGCCCAAAGAGACCCATG
CCTTTGGGAGAGATTAAAGCAGCTGTGTAATGGTTAGCTAAGGTTAAGTTACTAACCCAGCAGCTGATAGTAATTCAAAA
ATACAGTAGAGGACCAGAGAGGGGCGGGGGGGGGGGGTGGGGAGAAAGAGAGGAAGAGGAAGAGAGAGAGAGAGAGAGAG
GCATTCCCTAGCAAGCAGCCAAGGCCCTACCTTAATCCCCAGCACAGCTAATAAAATTAATCACTACACAAAAAA
Sequence Type mRNA
Unitrap ID UNI12845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15089048..15089437 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]

 
Come back to gene ENSMUSG00000031938


For any suggestions or comments, please send an email to unitrap@crg.es